Skip to main content

CRIME AND DNA

 

    

      Every cell in the body holds DNA (deoxy ribonucleic acid), a complex molecule made up of smaller molecules called nucleotides.  There are four types of nucleotide 1. cystonine (c) 2. guanine(g) 3. adenine(A) 4. Thymine(T).  DNA is arranged into structures called chromosomes.  They make up human genome.  The full genome holds 6.5 million characters made up of C, G, A, and T, while a 300-page book has 300000 characters made up of 26 alphabets.  Human Genome project transcribed all the nucleotides (characters).  It took two decades.  More than 90 % of our DNA is like Monkey's DNA.  Our characteristics such as hair color, eye color, height and other physical features are coded in the 2% of our DNA.  The purpose of remaining 98% of the DNA is just being identified. 

    In certain regions of our DNA, there are unique repeating patterns that can be used to differentiate one person from another.  There patterns are known as short-tandem-repeats-STR. 
Example: TACATACATACATACATACA 
Here TACA repeats. 
     Some regions of DNA may have 10 STR, other regions may have 13.  Finally, 'the number of STR in each region is our ID".  No two persons have same number of STR in all the regions.  But, two persons may have same number of STR in just one location.  Even that has a chance of one in ten million. 
     Blood cells, sweat, body-fluids, skin-cells left behind at the crime scene can be examined for their unique 'STR signature" to link a person to the sample.  Hence fool (full) -proof crime is impossible. 

 
FOOT NOTE:  

'Twins may have same STR signature'.  Besides DNA evidence other evidences strengthen and strengthen the criminal case.        

 The nature, plant and animals build themselves using DNA blueprint.  Even banana's DNA and ours are mostly same.  Today, we know that information and coding is key.  Hence nature's key also DNA coding.  Even virus have DNA coding.  Tomorrows medicine will be based on DNA. 


Labels

Labels:

Comments

Post a Comment

Popular posts from this blog

Your heart -you do not know

  Size and Location: The human heart is roughly the size of a clenched fist and is located slightly to the left of the center of the chest. Despite its relatively small size, the heart plays a crucial role in pumping blood throughout the entire body. Heartbeat Variability: The heart does not beat at a constant rate. The interval between heartbeats can vary, and this variability is considered a sign of a healthy heart. Factors such as breathing, emotions, and physical activity influence the heartbeat. Electrical Conduction: The heart's contractions are controlled by electrical impulses. The sinoatrial (SA) node, often called the "natural pacemaker," generates electrical signals that regulate the heartbeat and coordinate the pumping of blood. Blood Pumping Capacity: On average, the human heart pumps about 2,000 gallons (or 7,570 liters) of blood each day. Over a lifetime, this amounts to pumping enough blood to fill several Olympic-sized swimming pools. Heart Chambers and V...
Post a Comment
Read more

How does your smart phone detect motion, steps, rotation, and location?

 How it works-1  An accelerometer in a smartphone is a microelectromechanical system (MEMS) device that measures acceleration and tilt. It works by detecting changes in motion by measuring the vibration or acceleration of the device. The accelerometer consists of a small mass suspended on a spring inside a sealed chamber. When the device is subjected to acceleration, the mass moves relative to the device, causing a change in capacitance that can be measured and processed by the smartphone's hardware. The accelerometer measures acceleration in three dimensions (x, y, and z) and provides data that the smartphone's software can use to determine the device's orientation, detect motion, and track changes in velocity and acceleration. The accelerometer is used for a variety of purposes in a smartphone, including screen rotation, motion tracking for games and fitness apps, and detecting the position of the device for navigation and location services. Additionally, it can be used t...
Post a Comment
Read more

How smart watch measures heart rate?

       Heart rate monitors in smartwatches typically use photoplethysmography (PPG) technology to measure the wearer's heart rate. PPG is a non-invasive method that uses light to measure changes in blood volume and flow within the body. In smartwatches, this is usually done by shining light from an LED onto the skin, and then detecting the changes in light that result from the pumping of blood through the veins. The smartwatch typically has sensors that pick up the light reflected from the skin and convert it into an electrical signal, which is then processed to determine the wearer's heart rate. This measurement can be taken continuously, or at specific intervals, to provide a real-time reading of the wearer's heart rate. Why green LED: G reen light has a longer wavelength than red light, which makes it easier to detect changes in blood volume and flow through the skin. This is because the longer wavelength of green light is better able to penetrate the s...
Post a Comment
Read more