Skip to main content

CRIME AND DNA

 

    

      Every cell in the body holds DNA (deoxy ribonucleic acid), a complex molecule made up of smaller molecules called nucleotides.  There are four types of nucleotide 1. cystonine (c) 2. guanine(g) 3. adenine(A) 4. Thymine(T).  DNA is arranged into structures called chromosomes.  They make up human genome.  The full genome holds 6.5 million characters made up of C, G, A, and T, while a 300-page book has 300000 characters made up of 26 alphabets.  Human Genome project transcribed all the nucleotides (characters).  It took two decades.  More than 90 % of our DNA is like Monkey's DNA.  Our characteristics such as hair color, eye color, height and other physical features are coded in the 2% of our DNA.  The purpose of remaining 98% of the DNA is just being identified. 

    In certain regions of our DNA, there are unique repeating patterns that can be used to differentiate one person from another.  There patterns are known as short-tandem-repeats-STR. 
Example: TACATACATACATACATACA 
Here TACA repeats. 
     Some regions of DNA may have 10 STR, other regions may have 13.  Finally, 'the number of STR in each region is our ID".  No two persons have same number of STR in all the regions.  But, two persons may have same number of STR in just one location.  Even that has a chance of one in ten million. 
     Blood cells, sweat, body-fluids, skin-cells left behind at the crime scene can be examined for their unique 'STR signature" to link a person to the sample.  Hence fool (full) -proof crime is impossible. 

 
FOOT NOTE:  

'Twins may have same STR signature'.  Besides DNA evidence other evidences strengthen and strengthen the criminal case.        

 The nature, plant and animals build themselves using DNA blueprint.  Even banana's DNA and ours are mostly same.  Today, we know that information and coding is key.  Hence nature's key also DNA coding.  Even virus have DNA coding.  Tomorrows medicine will be based on DNA. 


Labels:

Comments

Post a Comment

Popular posts from this blog

THE WORK HORSE "="

    One cannot think of  a mathematical step without 'is equal to ' .  It balances right hand side and left hand side.  It aids simplification and manipulation of a mathematical expression. example: 2(A+B)  = C 2A+2B  = C         2A = C-2B           A = C-2B/ 2   In an electronic calculator,  the pressing of ' = " sign executes an asthmatic expression  or simply calculates.       In computer languages, it plays very important role.                                                                 A = B   When a computer looks at this expression, the value stored in the location named B is just transferred to the storage named A .  After execution both A and B will have the same value an...
Post a Comment
Read more

DISORDER IS THE "ORDER OF THE DAY"

         Imagine a balloon full of air.  The air molecules are moving randomly inside the balloon.  Let us pierce the balloon with a pin.  The air rushes out.  Why should not the air molecules stay inside the balloon safely and ignore the little hole?  That is not the way the world works.  The molecules always "want to occupy as many states as possible".  Hence the air goes out in the open to occupy more volume.   The things always goes into disorder (entropy) and the disorder increases with time.  The above statement is what we call "second law of thermodynamics".      Consider a cup of coffee on the table. Suppose the heat from entire room flows to your cup of coffee, the coffee will boil and the rest of the room will freeze.  Freezing means bringing things to order and arrangement.  It violates the second law.  Hence it will never happen.  Hence heat must flow from high ...
Post a Comment
Read more

Your heart -you do not know

  Size and Location: The human heart is roughly the size of a clenched fist and is located slightly to the left of the center of the chest. Despite its relatively small size, the heart plays a crucial role in pumping blood throughout the entire body. Heartbeat Variability: The heart does not beat at a constant rate. The interval between heartbeats can vary, and this variability is considered a sign of a healthy heart. Factors such as breathing, emotions, and physical activity influence the heartbeat. Electrical Conduction: The heart's contractions are controlled by electrical impulses. The sinoatrial (SA) node, often called the "natural pacemaker," generates electrical signals that regulate the heartbeat and coordinate the pumping of blood. Blood Pumping Capacity: On average, the human heart pumps about 2,000 gallons (or 7,570 liters) of blood each day. Over a lifetime, this amounts to pumping enough blood to fill several Olympic-sized swimming pools. Heart Chambers and V...
Post a Comment
Read more