CRIME AND DNA

 

    

      Every cell in the body holds DNA (deoxy ribonucleic acid), a complex molecule made up of smaller molecules called nucleotides.  There are four types of nucleotide 1. cystonine (c) 2. guanine(g) 3. adenine(A) 4. Thymine(T).  DNA is arranged into structures called chromosomes.  They make up human genome.  The full genome holds 6.5 million characters made up of C, G, A, and T, while a 300-page book has 300000 characters made up of 26 alphabets.  Human Genome project transcribed all the nucleotides (characters).  It took two decades.  More than 90 % of our DNA is like Monkey's DNA.  Our characteristics such as hair color, eye color, height and other physical features are coded in the 2% of our DNA.  The purpose of remaining 98% of the DNA is just being identified. 

    In certain regions of our DNA, there are unique repeating patterns that can be used to differentiate one person from another.  There patterns are known as short-tandem-repeats-STR. 
Example: TACATACATACATACATACA 
Here TACA repeats. 
     Some regions of DNA may have 10 STR, other regions may have 13.  Finally, 'the number of STR in each region is our ID".  No two persons have same number of STR in all the regions.  But, two persons may have same number of STR in just one location.  Even that has a chance of one in ten million. 
     Blood cells, sweat, body-fluids, skin-cells left behind at the crime scene can be examined for their unique 'STR signature" to link a person to the sample.  Hence fool (full) -proof crime is impossible. 

 
FOOT NOTE:  

'Twins may have same STR signature'.  Besides DNA evidence other evidences strengthen and strengthen the criminal case.        

 The nature, plant and animals build themselves using DNA blueprint.  Even banana's DNA and ours are mostly same.  Today, we know that information and coding is key.  Hence nature's key also DNA coding.  Even virus have DNA coding.  Tomorrows medicine will be based on DNA.