Skip to main content

CRIME AND DNA

 

    

      Every cell in the body holds DNA (deoxy ribonucleic acid), a complex molecule made up of smaller molecules called nucleotides.  There are four types of nucleotide 1. cystonine (c) 2. guanine(g) 3. adenine(A) 4. Thymine(T).  DNA is arranged into structures called chromosomes.  They make up human genome.  The full genome holds 6.5 million characters made up of C, G, A, and T, while a 300-page book has 300000 characters made up of 26 alphabets.  Human Genome project transcribed all the nucleotides (characters).  It took two decades.  More than 90 % of our DNA is like Monkey's DNA.  Our characteristics such as hair color, eye color, height and other physical features are coded in the 2% of our DNA.  The purpose of remaining 98% of the DNA is just being identified. 

    In certain regions of our DNA, there are unique repeating patterns that can be used to differentiate one person from another.  There patterns are known as short-tandem-repeats-STR. 
Example: TACATACATACATACATACA 
Here TACA repeats. 
     Some regions of DNA may have 10 STR, other regions may have 13.  Finally, 'the number of STR in each region is our ID".  No two persons have same number of STR in all the regions.  But, two persons may have same number of STR in just one location.  Even that has a chance of one in ten million. 
     Blood cells, sweat, body-fluids, skin-cells left behind at the crime scene can be examined for their unique 'STR signature" to link a person to the sample.  Hence fool (full) -proof crime is impossible. 

 
FOOT NOTE:  

'Twins may have same STR signature'.  Besides DNA evidence other evidences strengthen and strengthen the criminal case.        

 The nature, plant and animals build themselves using DNA blueprint.  Even banana's DNA and ours are mostly same.  Today, we know that information and coding is key.  Hence nature's key also DNA coding.  Even virus have DNA coding.  Tomorrows medicine will be based on DNA. 


Comments

Popular posts from this blog

DISORDER IS THE "ORDER OF THE DAY"

         Imagine a balloon full of air.  The air molecules are moving randomly inside the balloon.  Let us pierce the balloon with a pin.  The air rushes out.  Why should not the air molecules stay inside the balloon safely and ignore the little hole?  That is not the way the world works.  The molecules always "want to occupy as many states as possible".  Hence the air goes out in the open to occupy more volume.   The things always goes into disorder (entropy) and the disorder increases with time.  The above statement is what we call "second law of thermodynamics".      Consider a cup of coffee on the table. Suppose the heat from entire room flows to your cup of coffee, the coffee will boil and the rest of the room will freeze.  Freezing means bringing things to order and arrangement.  It violates the second law.  Hence it will never happen.  Hence heat must flow from high ...

THE EARTH, A SUPER ORGANISM

     JOIN MY COURSE: "Become a programmer in a day with python"       A man called 'love lock' (what a name) proposed a theory called Gaia theory, named after Greek Goddess.      It says, "Earth is a self-regulating organism like a human being.  The organic life in it interacts with in-organic matter and maintains atmosphere, temperature and environment".  Hence the earth is still suitable for the life to thrive.      Imagine, in a particular place, there are lot of flowers.  Some flowers are white and some are darkly coloured.  We know, white reflects light and heat while dark absorbs the same.  White flowers can thrive in hot climate.  But dark flowers requires cold climate.  The absorption and reflection balances and the environment reaches average, warm temperature at which both the flowers can co-exist.  This is the essence of "Gaia" theory.      On our earth, ...

THE PARABOLA

          A jet of water shooting from a hose pipe will follow a parabolic path.  What is the so special about parabola.    Y= x^2 Draw a graph for the above equation.  It will result in a parabola.  This parabola is also called unit parabola.  Any equation involving square will yield a parabola. Example:  Y = 2x^2 +3x+3 (also called quadratic equation)    X= 2 and -2, both  satisfies the equation 4 = X^2.  Parabolic equations always have two solutions.     Any motion taking place freely under gravity follows parabolic path. Examples:   An object dropped from a moving train,   A bomb dropped from flying plane,  A ball kicked upwards.      If a beam of light rays fall on the parabolic shaped mirror, they will be reflected and brought to focus on a point.  This fact is made use of in Dish Antenna, Telescope mirrors, etc.   ...